Ntbbf1arrolb
WebIn the promoter of the WUS gene of Arabidopsis and its two orthologs in Populus trichocarpa (PopWUS1 and PopWUS2) various auxin sensitive elements were detected: AuxRE, … Web1 jun. 2010 · A prerequisite for biotechnological improvements of storage roots is the availability of tissue-specific promoters enabling high expression of transgenes. In this work, we cloned two genomic fragments, pMe1 and pDJ3S , controlling the expression of a gene with unknown function from cassava ( Manihot esculenta ) and of the storage protein …
Ntbbf1arrolb
Did you know?
Web9 okt. 2014 · -2801 ggctggtttctaagacattttttggtttaatccaaacctaattacaa atatt cccaacaa rootmotiftapox1 -2741 gatcgaatgatctatggctacaaaccctatcccaacaaaaaactacatttagtacatcaa -2681 ... Web12 mrt. 2012 · NTBBF1ARROLB: 10: Required for tissue-specific expression and auxin induction; Agrobacterium rhizogenes: SEBFCONSSTPR10A: 3: Similar to the auxin …
Web9 nov. 2024 · Main conclusion Several cis-elements including Myb-binding motifs together confer glandular trichome specificity as revealed from heterologous expression and … WebAnalysis of signal sequence motifs in the promoter regions of the Arabidopsis class 1 and class 2 Pgbs
Web16 apr. 2015 · Furthermore, the SlARF9 promoter sequence contains several NTBBF1ARROLB-elements. These elements were first identified in the promoter sequence of rolB , one of the oncogenes present in the T-DNA sequence of Agrobacterium rhizogenes , and are involved in the auxin-inducible expression of the rolB -gene in plants ( … Web4 mei 2015 · Notably, seven auxin-responsive cis-elements (NTBBF1ARROLB and AUXREPSIAA4)/auxin response factor-binding sites (ARFAT) and 11 nodulin consensus …
WebGenerate, customise, save, share, gift, print, browse & love word cloud art with WordItOut, the free word cloud maker online since 2010.
Web10 nov. 2024 · We chose to focus on three auxin response elements: the AuxRR-core (GGTCCAT), TGA-element (AACGAC), and ntBBF1ARROLB (named BBF) (ACTTTA), … is bhediya good movieWebpssdr1 pscxe1 psat1 cyp82y1 cyp82x1 cyp82x2 cyp719a21 psmt3 psmt2 psmt1 s000042 iro2os cacgtgg s000505 prolaminboxosglub1 tgcaaag s000354 tgtcacacmcucumisin tgtcaca is bheeshma hit or flopWeb1 mei 2014 · Among these elements, NTBBF1ARROLB motif (ACTTTA) is the binding site for NtBBF1 (Dof protein) and is required for auxin induction, gene expressions in … is bhel a maharatna companyWeb1 jun. 2009 · We describe the development of a reporter system for monitoring meristem initiation in poplar using promoters of poplar homologs to the meristem-active regulatory genes WUSCHEL ( WUS ) and SHOOTMERISTEMLESS ( STM ). When ~3 kb of the 5′ flanking regions of close homologs were used to drive expression of the GUSPlus gene, … is bhediya on prime videoWeb16 feb. 2024 · Among the enriched CAREs, four (NTBBF1ARROLB, SORLIP5AT, ANAC_C3b and E2FCONSENSUS) were unique to a given subnetwork, and two (RVE1–2 and LECPLEACS2) were only co-enriched in the VviATL89 (VIT ... is bhel good for healthWeb15 jan. 2024 · Some cis-elements involved in the regulation of light-controlled genes such as INRNTPSADB, NTBBF1ARROLB and TBOXATGAPB were also part of the deleted … onenet_subscribeWeb8 okt. 2024 · Verticillium wilt caused by Verticillium dahliae is the most serious disease in cotton. Ve gene isolated from Gossypium barbadense is one of the resistant genes … onenet save the children international